fis1 shrna Search Results



N/A
OmicsLink™ shRNA clone collections include lentiviral and non-viral vector-based shRNA constructs against genome-wide human, mouse and rat genes. shRNA of varying lengths (19 to 29 bases) were designed using a proprietary algorithm to make shRNA
  Buy from Supplier

93
OriGene fis1 c shrna plasmid
a ) Representative images of dendritic mitochondria (red), and their overlap with endogenous <t>Fis1</t> (green). b ) Representative images of axonal mitochondria (red), and their overlap with endogenous Fis1 (green). c ) Quantification of relative Fis1 intensity levels showing that dendritic mitochondria have more Fis1 associated with them than do axonal mitochondria. p value is indicated in the figure following a Mann-Whitney test. Dendrites = 115 mitochondria; Axons = 117 mitochondria. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values. Scale bars, 5 μm.
Fis1 C Shrna Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fis1+shrna/bio_rxiv__2025__01__07__631801-122-0-7?v=OriGene
Average 93 stars, based on 1 article reviews
fis1 c shrna plasmid - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology fis1 shrna
a ) Representative images of dendritic mitochondria (red), and their overlap with endogenous <t>Fis1</t> (green). b ) Representative images of axonal mitochondria (red), and their overlap with endogenous Fis1 (green). c ) Quantification of relative Fis1 intensity levels showing that dendritic mitochondria have more Fis1 associated with them than do axonal mitochondria. p value is indicated in the figure following a Mann-Whitney test. Dendrites = 115 mitochondria; Axons = 117 mitochondria. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values. Scale bars, 5 μm.
Fis1 Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fis1+shrna/bio_rxiv__64898__2026__03__23__713823-277-146-155?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
fis1 shrna - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

N/A
Fis1 Rat shRNA lentiviral particles 4 unique 29mer target specific shRNA 1 scramble control 0 5 ml each 10 7 TU ml
  Buy from Supplier

N/A
Fis1 Mouse 4 unique 29mer shRNA constructs in retroviral untagged vector
  Buy from Supplier

N/A
Gene Silencers generally consist of pools of three to five target-specific 19-25 nucleotide sequences in length. For independent verification of Fis1 gene silencing results, individual duplex components or plasmids are also available upon request. Suitable
  Buy from Supplier


N/A
FIS1 Human 4 unique 29mer shRNA constructs in retroviral untagged vector
  Buy from Supplier

N/A
Fis1 Rat 4 unique 29mer shRNA constructs in retroviral untagged vector
  Buy from Supplier

N/A
Fis1 Mouse shRNA lentiviral particles 4 unique 29mer target specific shRNA 1 scramble control 0 5 ml each 10 7 TU ml
  Buy from Supplier

Image Search Results


a ) Representative images of dendritic mitochondria (red), and their overlap with endogenous Fis1 (green). b ) Representative images of axonal mitochondria (red), and their overlap with endogenous Fis1 (green). c ) Quantification of relative Fis1 intensity levels showing that dendritic mitochondria have more Fis1 associated with them than do axonal mitochondria. p value is indicated in the figure following a Mann-Whitney test. Dendrites = 115 mitochondria; Axons = 117 mitochondria. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values. Scale bars, 5 μm.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Representative images of dendritic mitochondria (red), and their overlap with endogenous Fis1 (green). b ) Representative images of axonal mitochondria (red), and their overlap with endogenous Fis1 (green). c ) Quantification of relative Fis1 intensity levels showing that dendritic mitochondria have more Fis1 associated with them than do axonal mitochondria. p value is indicated in the figure following a Mann-Whitney test. Dendrites = 115 mitochondria; Axons = 117 mitochondria. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values. Scale bars, 5 μm.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: MANN-WHITNEY

a ) Representative images of western blots for knockdown of HA-tagged Fis1 by the indicated shRNA constructs with Gapdh as a loading control to demonstrate that both shRNA constructs effectively knockdown Fis1. b ) Representative images of western blots to demonstrate that the HA-Fis1 impervious construct is not knocked down by the shRNA. c ) Representative images of a 14DIV cortical neuron electroporated with mt-YFP (green) and HA-Fis1 impervious (magenta) to show that HA-Fis1 impervious expresses and is largely co-localized with mitochondria. d ) Representative images of EGxxFP expression following cutting with Fis1 CRISPR guides demonstrating effective cutting. e ) Representative images showing that both the shRNA and CRISPR constructs result in a significant reduction in endogenous Fis1 following electroporation compared to un-electroporated neighboring cells. p value is indicated in the figure following a Kruskal-Wallis test in a, or Brown-Forsythe and Welch ANOVA test in d,e. Control in a = 9 wells; Fis1 386 shRNA in a = 9 wells; Fis1 C shRNA in a = 9 wells. No guide in d = 4 wells; Fis1 guide exon 3 in d = 4 wells; Fis1 guide exon 4 in d = 4 wells. Control in d = 19 cells; Fis1 386 shRNA in d = 19 cells; CRISPR KO in d = 20 cells. Data are shown as scatter plots with bar showing mean with SEM. Scale bars, 10 μm in c,e; 100 μm in d.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Representative images of western blots for knockdown of HA-tagged Fis1 by the indicated shRNA constructs with Gapdh as a loading control to demonstrate that both shRNA constructs effectively knockdown Fis1. b ) Representative images of western blots to demonstrate that the HA-Fis1 impervious construct is not knocked down by the shRNA. c ) Representative images of a 14DIV cortical neuron electroporated with mt-YFP (green) and HA-Fis1 impervious (magenta) to show that HA-Fis1 impervious expresses and is largely co-localized with mitochondria. d ) Representative images of EGxxFP expression following cutting with Fis1 CRISPR guides demonstrating effective cutting. e ) Representative images showing that both the shRNA and CRISPR constructs result in a significant reduction in endogenous Fis1 following electroporation compared to un-electroporated neighboring cells. p value is indicated in the figure following a Kruskal-Wallis test in a, or Brown-Forsythe and Welch ANOVA test in d,e. Control in a = 9 wells; Fis1 386 shRNA in a = 9 wells; Fis1 C shRNA in a = 9 wells. No guide in d = 4 wells; Fis1 guide exon 3 in d = 4 wells; Fis1 guide exon 4 in d = 4 wells. Control in d = 19 cells; Fis1 386 shRNA in d = 19 cells; CRISPR KO in d = 20 cells. Data are shown as scatter plots with bar showing mean with SEM. Scale bars, 10 μm in c,e; 100 μm in d.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Western Blot, Knockdown, shRNA, Construct, Control, Expressing, CRISPR, Electroporation

a ) Representative dendritic segments from 17DIV cortical neurons showing mitochondrial morphology via matrix targeted YFP for each of the labeled conditions. b ) Quantification of mitochondrial lengths for each of the indicated conditions demonstrating that loss of Fis1 results in shorter dendritic mitochondria. c ) Representative dendritic segments from P21 layer 2/3 cortical neurons showing mitochondrial morphology via matrix targeted YFP for each of the labeled conditions in vivo. d ) Quantification of mitochondrial lengths for each of the indicated conditions demonstrating that loss of Fis1 in vivo recapitulates the mitochondrial phenotype observed in cultured neurons. Control in vitro = 546 mitochondria; Fis1 386 shRNA in vitro = 873 mitochondria; Fis1 C shRNA in vitro = 262 mitochondria; CRISPR control in vitro = 949 mitochondria; CRISPR KO in vitro = 1613 mitochondria; Control in vivo = 91 mitochondria; Fis1 386 shRNA in vivo = 272 mitochondria; Fis1 C shRNA in vivo = 217 mitochondria. p values are indicated in the figure following Kruskal-Wallis tests. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values. Scale bars, 5 μm in a, 10 μm in c.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Representative dendritic segments from 17DIV cortical neurons showing mitochondrial morphology via matrix targeted YFP for each of the labeled conditions. b ) Quantification of mitochondrial lengths for each of the indicated conditions demonstrating that loss of Fis1 results in shorter dendritic mitochondria. c ) Representative dendritic segments from P21 layer 2/3 cortical neurons showing mitochondrial morphology via matrix targeted YFP for each of the labeled conditions in vivo. d ) Quantification of mitochondrial lengths for each of the indicated conditions demonstrating that loss of Fis1 in vivo recapitulates the mitochondrial phenotype observed in cultured neurons. Control in vitro = 546 mitochondria; Fis1 386 shRNA in vitro = 873 mitochondria; Fis1 C shRNA in vitro = 262 mitochondria; CRISPR control in vitro = 949 mitochondria; CRISPR KO in vitro = 1613 mitochondria; Control in vivo = 91 mitochondria; Fis1 386 shRNA in vivo = 272 mitochondria; Fis1 C shRNA in vivo = 217 mitochondria. p values are indicated in the figure following Kruskal-Wallis tests. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values. Scale bars, 5 μm in a, 10 μm in c.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Labeling, In Vivo, Cell Culture, Control, In Vitro, shRNA, CRISPR

a ) Representative images of axonal mitochondria in a 17DIV neuron co-electroporated with mt-YFP and control plasmid. b ) Representative images of axonal mitochondria in a 17DIV neuron co-electroporated with mt-YFP and Fis1 386 shRNA. c ) Representative images of axonal mitochondria in a 17DIV neuron co-electroporated with mt-YFP and CRISPR control plasmid. d ) Representative images of axonal mitochondria in a 17DIV neuron co-electroporated with mt-YFP and CRISPR Fis1 KO plasmids. e ) Quantification of mitochondrial length showing that neither Fis 1 knockdown construct alters axonal mitochondrial length. Control axonal mitochondria = 22 segments, 118 mitochondria; Fis1 386 shRNA axonal mitochondria = 14 segments, 90 mitochondria; Fis1 C shRNA axonal mitochondria = 21 segments, 130 mitochondria; Control CRISPR axonal mitochondria = 53 segments, 621 mitochondria; CRISPR Fis1 KO axonal mitochondria = 54 segments, 638 mitochondria. p values are indicated in the figure following Kruskal-Wallis tests. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values. Scale bars, 5 μm.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Representative images of axonal mitochondria in a 17DIV neuron co-electroporated with mt-YFP and control plasmid. b ) Representative images of axonal mitochondria in a 17DIV neuron co-electroporated with mt-YFP and Fis1 386 shRNA. c ) Representative images of axonal mitochondria in a 17DIV neuron co-electroporated with mt-YFP and CRISPR control plasmid. d ) Representative images of axonal mitochondria in a 17DIV neuron co-electroporated with mt-YFP and CRISPR Fis1 KO plasmids. e ) Quantification of mitochondrial length showing that neither Fis 1 knockdown construct alters axonal mitochondrial length. Control axonal mitochondria = 22 segments, 118 mitochondria; Fis1 386 shRNA axonal mitochondria = 14 segments, 90 mitochondria; Fis1 C shRNA axonal mitochondria = 21 segments, 130 mitochondria; Control CRISPR axonal mitochondria = 53 segments, 621 mitochondria; CRISPR Fis1 KO axonal mitochondria = 54 segments, 638 mitochondria. p values are indicated in the figure following Kruskal-Wallis tests. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values. Scale bars, 5 μm.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Control, Plasmid Preparation, shRNA, CRISPR, Knockdown, Construct

a ) Photo-activated mitochondria in a control dendrite at t=0 (red) and at t=15 minutes (green). The merged images showing overlap of the two timepoints and a kymograph of the entire 15 minute imaging session demonstrating little dendritic mitochondria movement in mature dendrites. b,c ) Photo-activated mitochondria in a Fis1 386 shRNA ( b ) or Fis1 C shRNA ( c ) dendrite at t= 0 (red) and at t=15 minutes (green). The merge images showing overlap of the two timepoints and a kymograph of the entire 15 minute imaging session demonstrating increased mitochondria motility following Fis1 knockdown. d ) Pie graphs showing percentages of stationary (dotted area), oscillating (checkered area), and motile (filled area) mitochondria in the dendrites of labeled conditions. e ) Quantification of motile mitochondria percentage for dendrite segments demonstrating increased motility in Fis1 knockdown neurons. f ) Scheme for photo-activation experiments to quantify fission and fusion dynamics in neuronal dendrites. g ) Quantification of dendritic mitochondria fission and fusion rates as events per 15 minutes for control and knockdown dendrites showing that both fission and fusion are increased upon Fis1 loss in neurons. Control motility = 37 segments, 663 mitochondria; Fis1 386 shRNA motility = 15 segments, 279 mitochondria; Fis1 C shRNA motility = 19 segments, 351 mitochondria; Control dynamics = 35 segments, 39 fission events, 57 fusion events; Fis1 386 shRNA dynamics = 31 segments, 75 fission events, 90 fusion events; Fis1 C shRNA dynamics = 30 segments, 64 fission events, 57 fusion events. p values are indicated in the figure following Kruskal-Wallis tests. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values for e, or individual points with mean ± SEM for g. Scale bars, 5 μm.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Photo-activated mitochondria in a control dendrite at t=0 (red) and at t=15 minutes (green). The merged images showing overlap of the two timepoints and a kymograph of the entire 15 minute imaging session demonstrating little dendritic mitochondria movement in mature dendrites. b,c ) Photo-activated mitochondria in a Fis1 386 shRNA ( b ) or Fis1 C shRNA ( c ) dendrite at t= 0 (red) and at t=15 minutes (green). The merge images showing overlap of the two timepoints and a kymograph of the entire 15 minute imaging session demonstrating increased mitochondria motility following Fis1 knockdown. d ) Pie graphs showing percentages of stationary (dotted area), oscillating (checkered area), and motile (filled area) mitochondria in the dendrites of labeled conditions. e ) Quantification of motile mitochondria percentage for dendrite segments demonstrating increased motility in Fis1 knockdown neurons. f ) Scheme for photo-activation experiments to quantify fission and fusion dynamics in neuronal dendrites. g ) Quantification of dendritic mitochondria fission and fusion rates as events per 15 minutes for control and knockdown dendrites showing that both fission and fusion are increased upon Fis1 loss in neurons. Control motility = 37 segments, 663 mitochondria; Fis1 386 shRNA motility = 15 segments, 279 mitochondria; Fis1 C shRNA motility = 19 segments, 351 mitochondria; Control dynamics = 35 segments, 39 fission events, 57 fusion events; Fis1 386 shRNA dynamics = 31 segments, 75 fission events, 90 fusion events; Fis1 C shRNA dynamics = 30 segments, 64 fission events, 57 fusion events. p values are indicated in the figure following Kruskal-Wallis tests. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values for e, or individual points with mean ± SEM for g. Scale bars, 5 μm.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Control, Imaging, shRNA, Knockdown, Labeling, Activation Assay

a ) Representative images of dendritic mitochondria co-electroporated with mt-YFP (top) and control plasmid followed by loading with TMRM (middle). b ) Representative images of dendritic mitochondria co-electroporated with mt-YFP (top) and Fis1 386 shRNA followed by loading with TMRM (middle). c ) Quantification of raw TMRM dendritic mitochondria intensities showing reduced membrane potential in Fis1 knockdown mitochondria. d ) Quantification of normalized mt-SypHer showing that Fis1 knockdown results in a slightly more acidic matrix pH. e ) Graph of relative TMRM intensity following treatment with antimycin A and FCCP. f ) Quantification showing dendritic mitochondria upon Fis1 loss are more sensitive to complex three inhibition. Control TMRMinitial = 155 mitochondria; Fis1 386 shRNA TMRMinitial = 90 mitochondria; Control mtSypHer = 155 mitochondria; Fis1 386 shRNA mtSypHer = 90 mitochondria; Control TMRManta = 113 mitochondria; Fis1 386 shRNA TMRManta = 117 mitochondria. p values are indicated in the figure following Mann-Whitney tests. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values for c,d & f, or mean ± SEM for e. Scale bars, 5 μm.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Representative images of dendritic mitochondria co-electroporated with mt-YFP (top) and control plasmid followed by loading with TMRM (middle). b ) Representative images of dendritic mitochondria co-electroporated with mt-YFP (top) and Fis1 386 shRNA followed by loading with TMRM (middle). c ) Quantification of raw TMRM dendritic mitochondria intensities showing reduced membrane potential in Fis1 knockdown mitochondria. d ) Quantification of normalized mt-SypHer showing that Fis1 knockdown results in a slightly more acidic matrix pH. e ) Graph of relative TMRM intensity following treatment with antimycin A and FCCP. f ) Quantification showing dendritic mitochondria upon Fis1 loss are more sensitive to complex three inhibition. Control TMRMinitial = 155 mitochondria; Fis1 386 shRNA TMRMinitial = 90 mitochondria; Control mtSypHer = 155 mitochondria; Fis1 386 shRNA mtSypHer = 90 mitochondria; Control TMRManta = 113 mitochondria; Fis1 386 shRNA TMRManta = 117 mitochondria. p values are indicated in the figure following Mann-Whitney tests. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values for c,d & f, or mean ± SEM for e. Scale bars, 5 μm.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Control, Plasmid Preparation, shRNA, Membrane, Knockdown, Inhibition, MANN-WHITNEY

a ) Representative intensity images of somatodendritic mitochondria in a 15DIV neuron co-electroporated with mt-GCaMP6f (intensity gradient) and control plasmid during a time course following glutamate uncaging. b ) Plot of normalized intensity of mt-GCaMP6f in control (grey) or Fis1 386 shRNA (blue) neurons following glutamate uncaging. c ) F max of mt-GCaMP6f following glutamate uncaging shows decreased calcium influx in Fis1 knockdown mitochondria. d ) Quantification of mt-GCaMP6f extinction after F max suggesting that Fis1 loss doesn’t affect mitochondrial calcium extrusion. e ) Quantification of F min Fluo4 showing increased resting cytoplasmic calcium levels in Fis1 knockdown neurons compared to surrounding wildtype neurons. f ) Quantification of cytoplasmic GCaMP6f confirming increased resting calcium levels in Fis1 knockdown neurons. g ) Peak GCaMP6f signals following glutamate uncaging show no difference in peak calcium levels in Fis1 knockdown neurons. Control mtGCaMP6f = 39 dendrites; Fis1 386 shRNA mtGCaMP6f = 33 dendrites; Control Fluo4 = 16 neurons; Fis1 386 shRNA Fluo4 = 16 neurons; Control cytoGCaMP6f = 35 neurons; Fis1 386 shRNA cytoGCaMP6f = 34 neurons. p values are indicated in the figure following Mann-Whitney tests (except e which is a Wilcoxon matched pairs test). Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values, except for e which is a paired comparison of values for each pair. Scale bar, 5 μm.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Representative intensity images of somatodendritic mitochondria in a 15DIV neuron co-electroporated with mt-GCaMP6f (intensity gradient) and control plasmid during a time course following glutamate uncaging. b ) Plot of normalized intensity of mt-GCaMP6f in control (grey) or Fis1 386 shRNA (blue) neurons following glutamate uncaging. c ) F max of mt-GCaMP6f following glutamate uncaging shows decreased calcium influx in Fis1 knockdown mitochondria. d ) Quantification of mt-GCaMP6f extinction after F max suggesting that Fis1 loss doesn’t affect mitochondrial calcium extrusion. e ) Quantification of F min Fluo4 showing increased resting cytoplasmic calcium levels in Fis1 knockdown neurons compared to surrounding wildtype neurons. f ) Quantification of cytoplasmic GCaMP6f confirming increased resting calcium levels in Fis1 knockdown neurons. g ) Peak GCaMP6f signals following glutamate uncaging show no difference in peak calcium levels in Fis1 knockdown neurons. Control mtGCaMP6f = 39 dendrites; Fis1 386 shRNA mtGCaMP6f = 33 dendrites; Control Fluo4 = 16 neurons; Fis1 386 shRNA Fluo4 = 16 neurons; Control cytoGCaMP6f = 35 neurons; Fis1 386 shRNA cytoGCaMP6f = 34 neurons. p values are indicated in the figure following Mann-Whitney tests (except e which is a Wilcoxon matched pairs test). Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values, except for e which is a paired comparison of values for each pair. Scale bar, 5 μm.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Control, Plasmid Preparation, shRNA, Knockdown, MANN-WHITNEY, Comparison

a ) Plot of normalized erGCaMP6-150 intensity in control (grey) or Fis1 386 shRNA (blue) neurons following glutamate uncaging. b ) Quantification of peak fluorescence decrease in control or Fis1 386 shRNA neurons showing slightly decreased, but not significant, ER calcium release in Fis1 KD neurons. c ) Plot of normalized erGCaMP6-150 intensity in control (grey) or Fis1 386 shRNA (blue) neurons following peak release. d ) Quantification of erGCaMP6-150 fluorescence recovery in control or Fis1 386 shRNA neurons showing decreased ER calcium re-uptake in Fis1 neurons. Control erGCaMP6-150 = 27 segments; Fis1 386 shRNA erGCaMP6-150 = 25 segments. p values are indicated in the figure following a Mann-Whitney test. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Plot of normalized erGCaMP6-150 intensity in control (grey) or Fis1 386 shRNA (blue) neurons following glutamate uncaging. b ) Quantification of peak fluorescence decrease in control or Fis1 386 shRNA neurons showing slightly decreased, but not significant, ER calcium release in Fis1 KD neurons. c ) Plot of normalized erGCaMP6-150 intensity in control (grey) or Fis1 386 shRNA (blue) neurons following peak release. d ) Quantification of erGCaMP6-150 fluorescence recovery in control or Fis1 386 shRNA neurons showing decreased ER calcium re-uptake in Fis1 neurons. Control erGCaMP6-150 = 27 segments; Fis1 386 shRNA erGCaMP6-150 = 25 segments. p values are indicated in the figure following a Mann-Whitney test. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Control, shRNA, Fluorescence, MANN-WHITNEY

a ) Representative traces of relative cytoplasmic GCaMP6f intensity to show spontaneous neuronal activity in 14DIV cultured cortical neurons electroporated with pCAG GCaMP6f and either control (left) or Fis1 386 shRNA (right). b ) A cumulative frequency distribution of the normalized GCaMP6f intensities showing a rightward shift in Fis1 knockdown neurons. c ) Quantification of the coefficient of variation demonstrating that Fis1 knockdown neurons have a higher variability in neuronal activity. Control cyto GCaMP6f = 121 neurons; Fis1 386 shRNA cyto GCaMP6f = 121 neurons. p value indicated in the figure following a Wilcoxon test. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Representative traces of relative cytoplasmic GCaMP6f intensity to show spontaneous neuronal activity in 14DIV cultured cortical neurons electroporated with pCAG GCaMP6f and either control (left) or Fis1 386 shRNA (right). b ) A cumulative frequency distribution of the normalized GCaMP6f intensities showing a rightward shift in Fis1 knockdown neurons. c ) Quantification of the coefficient of variation demonstrating that Fis1 knockdown neurons have a higher variability in neuronal activity. Control cyto GCaMP6f = 121 neurons; Fis1 386 shRNA cyto GCaMP6f = 121 neurons. p value indicated in the figure following a Wilcoxon test. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Activity Assay, Cell Culture, Control, shRNA, Knockdown

a-b ) Representative images of 14DIV cultured cortical neurons electroporated with tdTomato and either control (left, a) or Fis1 shRNA (right, b). c ) Quantification of dendritic branching showing that Fis1 knockdown neurons have increased branching. d ) Representative images of P14 layer 2/3 basal dendritic segments electroporated with Venus YFP and either control (top) or Fis1 shRNA (bottom) to visualize spine density. e ) Quantification of dendritic spine density at P14 demonstrating that loss of Fis1 results in a reduced spine density in vivo . p values are indicated in the figure following Mixed-effects analysis (c), or Mann-Whitney test (e). Control branching = 24 neurons; Fis1 386 shRNA branching = 24 neurons. Control spines = 51 segments; Fis1 386 shRNA branching = 37 segments. Data are shown as a plot of the number of crossings per distance from the cell body (b), or individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values (d). Scale bars, 100 μm for a, 5 μm for c.

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a-b ) Representative images of 14DIV cultured cortical neurons electroporated with tdTomato and either control (left, a) or Fis1 shRNA (right, b). c ) Quantification of dendritic branching showing that Fis1 knockdown neurons have increased branching. d ) Representative images of P14 layer 2/3 basal dendritic segments electroporated with Venus YFP and either control (top) or Fis1 shRNA (bottom) to visualize spine density. e ) Quantification of dendritic spine density at P14 demonstrating that loss of Fis1 results in a reduced spine density in vivo . p values are indicated in the figure following Mixed-effects analysis (c), or Mann-Whitney test (e). Control branching = 24 neurons; Fis1 386 shRNA branching = 24 neurons. Control spines = 51 segments; Fis1 386 shRNA branching = 37 segments. Data are shown as a plot of the number of crossings per distance from the cell body (b), or individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values (d). Scale bars, 100 μm for a, 5 μm for c.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Cell Culture, Control, shRNA, Knockdown, In Vivo, MANN-WHITNEY